pgem-4 (Promega)
90
Structured Review
Promega
pgem-4
Pgem 4, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem+4/pgem+t+easy/pmc10876878-67-31-5
Average 90 stars, based on 1 article reviews
Pgem 4, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem+4/pgem+t+easy/pmc10876878-67-31-5
Average 90 stars, based on 1 article reviews
pgem-4 - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Derivative Assay:Article Title: Manipulating the In Vivo mRNA Expression Profile of FSHβ to Resemble that of LHβ Does Not Promote a Concomitant Increase in Intracellular Storage of Follicle-Stimulating Hormone Article Snippet: The b-subunits of luteinizing hormone (LHb) and follicle-stimulating hormone (FSHb) are differentially expressed, and this may contribute to the unique expression and storage patterns of LH and FSH.. Therefore, to determine if the in vivo expression pro®le of FSHb could be altered to that of LHb, a truncated ovine FSHb (oFSHb) gene, which would encode a mRNA lacking the putative destabilizing 3k untranslated region, was fused downstream of the ovine LHb (oLHb) promoter and expressed in transgenic mice.. In two independent lines, line 16 and 17, we measured oFSHb, mouse LHb (mLHb) and mouse FSHb (mFSHb) mRNA levels: (i) after castration in males; (ii) after administering inhibin to ovariectomized mice; and (iii) during the oestrous cycle. Article Title: Metabolic Labeling and Recovery of Nascent RNA to Accurately Quantify mRNA Stability Article Snippet: Our experiments use a custom synthesized RNA (Dharmacon) with the following sequence: 5′- AUUUAGGUGACACUAUAG GA UCCUCUAG AGUCGA CCUUCUCCCUAUAGUGAGUCGUAUUA GCA[ 4-S-U] CAG-3′ The two underlined regions are the binding sites for the dPCR primers. .. The sequence is derived from the polylinker of Plasmid Preparation:Article Title: Site specificity of surfactant protein expression in airways of baboons during gestation Article Snippet: .. The specific DNA fragments (SP-A, SP-B, and SP-C) were subcloned into Sequencing:Article Title: Metabolic Labeling and Recovery of Nascent RNA to Accurately Quantify mRNA Stability Article Snippet: Our experiments use a custom synthesized RNA (Dharmacon) with the following sequence: 5′- AUUUAGGUGACACUAUAG GA UCCUCUAG AGUCGA CCUUCUCCCUAUAGUGAGUCGUAUUA GCA[ 4-S-U] CAG-3′ The two underlined regions are the binding sites for the dPCR primers. .. The sequence is derived from the polylinker of other:Article Title: NVL: a new member of the AAA family of ATPases localized to the nucleus. Article Snippet: sion, cell cycle control, mitotic/meiotic spindle interacWe report the cloning of NVL, a newly recognized tions, transcriptional regulation, intracellular proteolhuman gene that encodes an approximately 110-kDa ysis, and various mitochondrial functions (Confalonieri nuclear protein designated NVLp (nuclear VCP-like and Duguet, 1995).. At least 50 members of the AAA protein), which is a member of a rapidly growing famprotein family have been identified in a range of organily of ATP-binding proteins recently denoted the AAA isms from Archaebacterium to Homo sapiens. family (ATPases associated with diverse cellular activPorcine valosin-containing protein (VCP) was the ities) (W. H. Kunau et al., 1993, Biochimie 75: 209–224). first member of the AAA family to be identified (Koller NVL was isolated by degenerate PCR using oligonucleand Brownstein, 1987).. It contains two very similar otides corresponding to the yeast PEX1 gene, which ATP-binding modules likely arising from internal duis necessary for peroxisomal biogenesis. Clone Assay:Article Title: Liver-specific and proliferation-induced deoxyribonuclease I hypersensitive sites in the mouse insulin-like growth factor binding protein-1 gene. Article Snippet: .. A Sac I series of mouse IGFBP-1 genomic clones isolated from an NIH 3T3 library cloned into Isolation:Article Title: Liver-specific and proliferation-induced deoxyribonuclease I hypersensitive sites in the mouse insulin-like growth factor binding protein-1 gene. Article Snippet: .. A Sac I series of mouse IGFBP-1 genomic clones isolated from an NIH 3T3 library cloned into |
